This allele from project Arhgap44-8008J-F4654 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGACCCTGACTGCAGAT, ACTTAGTACAAGCACACACA, GCGGGTGGAAGATTTTCAGT and ATAGTTTACTAATATAACTG, which resulted in a 88 bp deletion beginning at Chromosome 11 negative strand position 65,067,147 bp CCTCTGACGACTCTGGCGCA, and ending after TAAGGTGACCCCATGTGTG at 65,067,060 bp (GRCm38/mm10). This mutation deletes 68 bp of exon 4 and 20 bp of 3-prime flanking intronic sequence including the splice donor. The deletion of part of exon 4 but retention of the splice acceptor is predicted to lead to amino acid change after residue 69 and early truncation 3 amino acids later due to read through into intron 5. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count