This allele from project Tmem87b-7963J-F1351 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAGTGATTTAGAGAAATT, CATTAAATTTTAACAGCTAC, CGTGTGTACAAAGCTGTGAA and CCAGCTGAGTAGGCTACAAG, which resulted in a 258 bp deletion beginning at Chromosome 2 positive strand position 128,824,346 bp, CAGCATTCTTGAAGCTTCAA, and ending after CTGAGTAGGCTACAAGTGGA at 128,824,603 bp (GRCm38/mm10). This mutation deletes exon 3 and 163 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7bp (TGCGTGT) insertion at the site of the 258 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 75 and early truncation 6 amino acids later. (J:188991)