Cep135^em1(IMPC)J

This allele from project Cep135-8015J-M4780 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTCTTTCAGGGTATCAAA, GGCCTGTTTTGAGAAACTTG, CTAACCACAGTTCTATTCAT and CCTAAAAACCAAAGAGGGCA, which resulted in a 383 bp deletion beginning at Chromosome 5 positive strand position 76,593,055 bp, TTTGAGAAACTTGAGGACCCT, and ending after TAATGAAGGCTCCTTGCCCTC at 76,593,437 bp (GRCm38/mm10). This mutation deletes exon 2 and 192 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 4 bp deletion (GAAT) 88 bp 3-prime of the 383 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. (J:188991)