This allele from project Atp2b3-8009J-F4670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATGACTCTATGGAACAAG, GTCCAGTCAGGGCCTTTGCA, TTACTAATACATCCTAGCAG and TGGGCATCTTAGGTGTAGAG, which resulted in a 464 bp deletion beginning at Chromosome X positive strand position 73,536,041 bp, AAGGCCCTGACTGGACTCAG, and ending after ACTTTACTAATACATCCTAG at 73,536,504 bp (GRCm38/mm10). This mutation deletes exon 9 and 249 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GTT) 50 bp 5-prime of the 464 bp deletion which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 374 and early truncation 5 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count