Using an sgRNA (targeting GAATATGTAGGCAAGAGTTTGAAC) and ssODN template (TTCTTAGTTTTTGAGGCCAGCAGAAAGGAAGCCAGAATATGTAGGCAAGAGTTGGAACAGGTGAAAAGACGGAGGTACGATGCTTTCAGTCAATGTTTTGAACACATCTCAGTCTCAATTGATCAA) with CRISPR/Cas9 technology, phenylalanine codon 1054 (TTT) was changed to leucine (TTG) (c.3162T>G, p.F1054L). This is the equivalent of the human p.F1055L mutation caused by SNP rs61735519. (J:226562)
Basic Information
FVB/NJ x B6(Cg)-Tyrc-2J/J
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count