Ccdc59^em1(IMPC)J

This allele from project Ccdc59-8014J-F4739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, AATGTTTTACTGACGACACA and TGAGGAATTTCTGAAGACGG, which resulted in a 495 bp deletion beginning at Chromosome 10 positive strand position 105,842,368 bp, CTTATATTTAGGTAAAGGGC, and ending after AGGAAGGTAAGCACCTCCGT at 105,842,862 bp (GRCm38/mm10). This mutation deletes exon 2 and 188 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 2 amino acids later. (J:188991)