Iqsec2^em1(IMPC)J

This allele from project Iqsec2-RI-8041J-M4925 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTGAGTGAATGAACCGTGT, TCTAGTGTACTCACTCAGTT, GGTTGGGGTGTGGCTCTTGA and AGATGGCTCTGGTTGAAAAA, which resulted in a 519 bp deletion beginning at Chromosome X positive strand position 152,202,730 bp, GAACCGTGTAGGCAGTGAAG, and ending after GTTGGGGTGTGGCTCTTGAG at 152,203,248 bp (GRCm38/mm10). This mutation deletes exon 3 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 245 and early truncation 13 amino acids later. (J:188991)