This allele from project 4931406P16Rik-7996J-M9596 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTTCTCAGGTAGCAGGG, AATAGAAGCCTAAACTCTGA, CGTATTAGTCACTCAGTAAC and GTTATCTCTGGGGGTCTCAC, which resulted in a 346 bp deletion beginning at Chromosome 7 negative strand position 34,254,222 bp, GGGGTCTCACTGGTCTCACTG, and ending after TGCACTTCTCAGGTAGCAG at 34,253,877 bp (GRCm38/mm10). This mutation deletes exon 8 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 418 and early truncation 63 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count