This allele from project Slc44a2-7954J-F6530 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGAAGAAGCTGGAGAGCCG, TGTGTCTGCATGCTACCAAC, TTTGCCGGAGAACACACACT and CACATCCCTCGTGGGGAAGA, which resulted in a 231 bp deletion beginning at Chromosome 9 positive strand position 21,338,315 bp TGTAGTCCCCTGTTGGTAGC, and ending after TGGGGAGATGTGTCCCAGTG at 21,338,545 bp (GRCm38/mm10). This mutation deletes exon 2 and 182 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion (A) at the site of the deletion that will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 13 and early truncation 15 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count