Tnks1bp1^em1(IMPC)J

This allele from project Tnks1bp1-7965J-M7446 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACTTGCACCTAGAACGAT, AGGTTGGAGTGTGGAAGATT, ATTCAGGCAAACCCAGGCTA and ATAGCCCCTTTAAGACTTCA, which resulted in a 837 bp deletion beginning at Chromosome 2 positive strand position 85,051,847 bp ATTCGGTGCAGCAGGAGTCA, and ending after TTCAGGCAAACCCAGGCTAA at 85,052,683 bp (GRCm38/mm10). This mutation deletes exon 3 and 206 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp deletion (GAACGATG) 24 bp before the 837 bp del and an 8 bp insertion (GCTTCCTT) at the site of the 837 bp del, which will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 32 and early truncation 7 amino acids later. (J:188991)