Serp2^em1(IMPC)J

This allele from project Serp2-7951J-M6651 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGAGGACAGCGGAGAACAC, CCTTAAACCTTAATCTTTAT, GTACGTGCTGAGGCTCCTAC and GACAGACTCTTGGATCCTAC, which resulted in a 222 bp deletion beginning at Chromosome 14 negative strand position 76,550,173 bp GATCCAAGAGTCTGTCACTC, and ending after TCACTGAATTATAGCCTGTG at 76,549,952 bp (GRCm38/mm10). This mutation deletes exon 2 and 149 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 8 amino acids later. (J:188991)