Rab40b^em1(IMPC)J

This allele from project Rab40b-7934J-M7095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes exon 2 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later. (J:188991)