Rab11b^em1(IMPC)J

This allele from project Rab11b-7933J-M7053 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGGGGCTGAACTAGAGCA, GTAGGGGCTGAACTAGAGCA, TTACCAGTGTGTCCCAGCGT and CACCCAGCAAACCTGCATGG, which resulted in a 549 bp deletion beginning at Chromosome 17 negative strand position 33,750,102 bp CCAGCGTGGGAAAATCCGTG, and ending after TTCCATTTTCACCCAACCTC at 33,749,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 353 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 18 amino acids later. (J:188991)