Osbpl10^em1(IMPC)J

This allele from project Osbpl10-7566J-F3946 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCACGCCATGTGTGCCCCG, TATCCAACCTAGTCATGTGA, GCAGCTGCCAGATAGGACAG and CTGCTACGTGCTTTAAGAGG, which resulted in a 403 bp deletion beginning at Chromosome 9 positive strand position 115,175,848 bp CATGACTAGGTTGGATATTT, and ending after CCTGCCTGGAACTCACCCCTG at 115,176,250 bp (GRCm38/mm10). This mutation deletes exon 4 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 5 amino acids later. (J:188991)