Slc25a46^em1(IMPC)J

This allele from project Slc25a46-7953J-M6621 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCTGTTAATAAAACCTAA, TCACTTTGAGGTTTATGCAG, TCAAATTCTGATATGGAACA and GTTTAAATAGTGAATGACTC, which resulted in a 365 bp deletion beginning at Chromosome 18 negative strand position 31,607,404 bp CAGAGTCATTCACTATTTAA, and ending after AGTCATTCCACTGCATAAAC at 31,607,040 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 70 amino acids later. (J:188991)