Nim1k^em1(IMPC)J

This allele from project Nim1k-7775J-M6390 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCTTTGGAGGCATGGACCA, GCCATGGGAACCGGGAACGT, TGATGATGATGTGTTATAAT and CTTTATTCTATTAGACATAG, which resulted in a 603 bp deletion beginning at Chromosome 13 negative strand position 119,714,667 bp GTTCTGACCAGGAGTGCTCT, and ending after CCTGCCATGGGAACCGGGAAC at 119,714,065 bp (GRCm38/mm10). This mutation deletes exon 3 and 334 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 1 amino acid later. In addition there is a 7 bp deletion (tccatgc) 96 bp after the 603 bp deletion that will not alter the results of the exon deletion. (J:188991)