Mpped2^em1(IMPC)J

This allele from project Mpped2-7894J-M7436 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTATGATGACTATTACGA, CACCCAAACAGTCTAACGCA, AGACCGGGAAAGGTTAATTG and ATTTCTTGTATGATATGCTG, which resulted in a 356 bp deletion beginning at Chromosome 2 positive strand position 106,744,649bp CGAGGGTTCTGACATGTTTA, and ending after ATTTCTTGTATGATATGCTG at 106,745,004 bp (GRCm38/mm10). This mutation deletes exon 3 and 174 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 4 amino acids later. (J:188991)