This allele from project Shisa7-7952J-M6633 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGAAATGTCCACAGCTGA, AGGATTGAGAGTGTCACATG, CTGTGGATGCCCTAAAGAAG and GCAGAGATGTGGTCCAGTTT, which resulted in a 399 bp deletion beginning at Chromosome 7 negative strand position 4,834,509 bp, CTGGACCACATCTCTGCACT, and ending after ATTCCAGTCTCCATCCATCA at 4,834,111 bp (GRCm38/mm10). This mutation deletes exon 3 and 244 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 32 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count