This allele from project Gas7-7889J-F7372 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCAACCCTGGGATGAGGA, CATGTGGCAGGGCCATCTAT, TAACAGTTCCTAATGATAGA and CTATTAGTGGAAAGAATCTC, which resulted in a 320 bp deletion beginning at Chromosome 11 negative strand position 67,643,151 bp GATGGCCCTGCCACATGAGA, and ending after CTGCTATTAGTGGAAAGAAT at 67,643,470 bp (GRCm38/mm10). This mutation deletes exon 4 and 234 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 31 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count