Ncbp2^em1(IMPC)J

This allele from project Ncbp2-7920J-M3809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAATCTCTATGTAAATAATC, TCTATGTAAATAATCTGGTT, CCTGAACTGAATCTCTGCCT and CAGGTCTTTTCGTCAGTTTG, which resulted in a 326 bp deletion beginning at Chromosome 16 positive strand position 31,956,177 bp GTAAATAATCTGGTTAGGTT, and ending after TACAGGTCTTTTCGTCAGTTT at 31,956,502 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 23 amino acids later. (J:188991)