Nrap^em1(IMPC)J

This allele from project Nrap-7921J-M3386 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTCGGGAGAGGTGCTACT, GCTCGCCACTGCATGACTTT, CCTGGAGGAGGACAGCTAAT and AGACTTTCAGGTTAAAAAGT, which resulted in a 248 bp deletion beginning at Chromosome 19 negative strand position 56,389,523 bp GAGGACAGCTAATTGGCAGA, and ending after CGAGTAGCACCTCTCCCGAG at 56,389,276 bp (GRCm38/mm10). This mutation deletes exon 2 and 153 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 3 amino acids later. (J:188991)