Jpt1^em1(IMPC)J

This allele from project Hn1-7890J-M7394 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAATCCGTGACTTTAACA, GGCGATCCTTGTTAAAGTCA, ATCGTAAACCCACTGATGGA and GCAGATGGATAAAGCACTGT, which resulted in a 500 bp deletion beginning at Chromosome 11 negative strand position 115,503,346 bp, TGTTGGTACCCTGACCCTCC, and ending after GCGATCCTTGTTAAAGTCAC at 115,502,847 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 3 amino acids later. (J:188991)