Cercam^em1(IMPC)J

This allele from project Cercam-7869J-F7768 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTCCCCCTCAGTGAACTC, AGGGAATCCTGTCTCAGACT, CTAGGCAGTAAATTTAGGAA and ACTAGCCCTTCTCCTCCACT, which resulted in a 674 bp deletion beginning at Chromosome 2 positive strand position 29,872,506 bp, TGAACTCTGGTCCCGAGTCT, and ending after CCTAAATTTACTGCCTAGTG at 29,873,179 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 334 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is a 13 bp insertion (agggaatttctca) at the site of the deletion that will not alter the results of the deletion, which is predicted to cause a change of amino acid sequence after residue 139 and early truncation 14 amino acids later. (J:188991)