This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a 314 bp deletion beginning at Chromosome 5 positive strand position 64,995,684 bp, GGGAGATGTGGTTGCTTGGT, and ending after GGAGTTTAACGTTTGCTCAG at 64,995,997 bp (GRCm38/mm10). This mutation deletes exon 3 and 226 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count