This allele from project Serpinb9c-7777J-M6430 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGCATGCGAAATAGATGTG, TGGAAGGAATATATTCACCT, TCAAAACAGTGATAATTCAG and TGTTTTGAAGCAGAGAAATA, which resulted in a 285 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 33,157,670 bp, TTCTCTGCTTCAAAACAGTG, and ending after TCCCCAGCCCCACCCCCACAT at 33157670 bp (GRCm38/mm10). This mutation deletes exon 2 and 107 bp of flanking intronic sequence including the splice acceptor and donor. At the site of the 285bp deletion there is a single T insertion, in addition there is a 21 bp deletion (atggaaggaatatattcacct) 32 bp after the 285 bp deletion that should not alter the results of the mutation. The mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count