This allele from project Tmem9b-7805J-M0788 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTGCTACATAAACCG, AAACAGAAAGCTCTAGGCCG, ATGGTTTTAGAATATCTGAC and TGGTTTTAGAATATCTGACA, which resulted in a 236 bp deletion around exon 2 beginning at Chromosome 7 negative strand position 109,750,210 bp, TTAGAATATCTGACAGGGAT, and ending after GGTATCACCTGCTACATAAA at 109,749,975 bp (GRCm38/mm10). This mutation deletes exon 2 and 144 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 28 bp insertion (gctcagtcccatctgaaatgaaacctcc) at this site as and a 4 bp deletion 140 bp after the 236 bp deletion, neither of which is expected to alter the result of the 236 bp deletion, which is predicted to cause early truncation after 36 amino acids. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count