This allele from project Snapc2-7778J-F6434 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTTCAGAGCGTGCAG, GTCCATTCTAGGTCTAGCAG, ATACTGTGTTTGTGTTGCGA and GTTGCGAGGGGGTTGTCTGG, which resulted in a 503 bp deletion around exon 4 beginning at Chromosome 8 positive strand position 4,254,919 bp, GGTCCATTCTAGGTCTAGCA, and ending after TACTGTGTTTGTGTTGCGAG at 4,255,421 bp (GRCm38/mm10). This mutation deletes exon 4 and 121 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 27 amino acids later. (J:188991)