Fam120a^em1(IMPC)J

This allele from project Fam120a-7754J-M691 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAAAAGATAGATAATGTC, GCTCTTCACTTGCACTCTCT, GGAGCAGTGTGTCACATGAT and AGTAGCTCTTTAAAGATGTC, which resulted in a 504 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 48,949,451 bp, ATGATTGGTCCTGGCACTTT, and ending after TGGGCTCTTCACTTGCACTC at 48,948,948 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 26 amino acids later. (J:188991)