Lgals4^em1(IMPC)J

This allele from project Lgals4-7682J-F3313 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCTCAGTCCCTTAAGCGG, GACCAGGTGAAGAGCCTCAG, GCACTTCCCCGCTCACCCCA and TCCCTAACTCTGATGCCAGG, which resulted in a 278 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 28,834,332 bp, CTCCTTACCCTAAGTCTCAT, and ending after TTCCCTAACTCTGATGCCAG at 28,834,609 bp (GRCm38/mm10). This mutation deletes exon 2 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. (J:188991)