This allele from project Ano8-7739J-F6550 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGTGACAGGGCCAGA, TCTCGCACAGTCCTTAGCTT, GGGCCTCCACATTTCCACCG and CCAATGGGTCTTGCCTCGAG, which resulted in a 228 bp deletion in exon 3 beginning at Chromosome 8 negative strand position 71,484,949 bp, TGGAAATGTGGAGGCCCTTGT, and ending after CCTGCCTCTACCTCCCTCT at 71,484,722 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 5 bp deletion 95 bp after the 228 bp deletion that will not affect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 14 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count