This allele from project Acod1-7676J-M9515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC, which resulted in a 370 bp deletion spanning exon 4 beginning at Chromosome 14 positive strand position 103,051,188 bp, ATTTTTAGGGTATAATTTCA, and ending after TGTGCCCATCAAGGAAAGCG at 103,051,557 bp (GRCm38/mm10). This mutation deletes exon 4 and 164 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 49 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count