Smarcd3^em1(IMPC)J

This allele from project Smarcd3-7699J-M8045 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCCCTTTCACGCGGGG, GCGACCAAGTCATTCTAGCT, CCGCCCCTCTCCAAGACCCT and CCCACTCATCGCTCAGCGCA, which resulted in a 471 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 24,598,924 bp, CAGGGTTACCAACCCAGGGT, and ending after CAGCGACCAAGTCATTCTAG at 24,598,454 bp (GRCm38/mm10). This mutation deletes exon 2 and 259 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later. (J:188991)