This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATTTGGTAATAAACTAAG, GAAACAGTTACTAGGACATT, TTTTAAATACCTTGCAGCTT and GCTGTGATTCCAAAGCTGCA into zygotes, which resulted in a 334 bp deletion at Chr 11: 80,692,846-80,693,179 bp (GRCm38/mm10). This deletion includes ENSMUSE00001265867. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count