Zscan12^em1(IMPC)J

This allele from project Zscan12-7729J-M3081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCCTGCTCAAGCCCGGA, TCGATCGCACTCATTTTTCA, GTTTCTCGTTAAAAGTGAGA and AACAGGCTGATAGGACCCCA, which resulted in a 298 bp deletion spanning exon 3 beginning at Chromosome 13 positive strand position 21,366,532 bp, GGGCTTGAGCAGGCAGGAGC, and ending after GCTGTTTCTCGTTAAAAGTG at 21,366,829 bp (GRCm38/mm10). This mutation deletes exon 3 and 156 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 14 amino acids later. (J:188991)