This allele from project Ssh1-7708J-M9161 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTTGTACGGTTGAAAAA, TCACCTACTTCCCGGACCTA, GATAAAGGCATCCAGGAAGG and CAGGGGGTGTGTCTCGAACA, which resulted in a 189 bp deletion spanning exon 2 beginning at Chromosome 5 negative strand position 113,989,807 bp, GTCTCGAACACGGCAGCCTC, and ending after CACTTGGCGTTTGTCCTTAG at 113,989,619 bp (GRCm38/mm10). This mutation deletes exon 2 and 148 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in early termination after amino acid residue 21. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count