Tomm40^em1(IMPC)J

This allele from project Tomm40-7713J-F6824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGCTGTTGTGACCTCTGGA, CCCCAAGCCTTTAAGAGTGA, TTGTGAAGAGAGCTTGGGAT and GGCCAAGGTTCCTCTAGTGG, which resulted in a 227 bp deletion spanning exon 2 beginning at Chromosome 7 negative strand position 19,714,445 bp, TGGTGGAATTAGTGAGATAA, and ending after ATGCATACAGATCCCCTCAC at 19,714,219 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 38 amino acids later. (J:188991)