This allele from project Prss36-7695J-F6710 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTATTCAGCCTGGACAGCG, GAAGGTTGAGCTGCTGCGCA, ACCGAGCTTTGACTTCTAGG and GAGACCCTGGTAACTCGGGG, which resulted in a 352 bp deletion spanning exon 4 beginning at Chromosome 7 negative strand position 127,945,488 bp, CCGAGTTACCAGGGTCTCTG, and ending after CTGGCAATGCCACGCTGTCC at 127,945,137 bp (GRCm38/mm10). This mutation deletes exon 4 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 35 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count