Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch

The U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3' part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wild-type gene (Rnu7) was obtained containing 341 bp 5' flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3' sequence (including the 3' box). The 5'GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3' region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11 but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei about 3 times more efficiently. The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting approximate 4.4 kbp transgene had the U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Line 4 has 8 copies of the transgene. (J:231141)