Using two sgRNAs and CRISPR/Cas9 technology (with D10A mutatnt of Cas9), 22 nucleotides (GTCAAAGGTTCAGGATGATTTT in NM_054066) were deleted from exon 3. Immunoblots with sperm derived protein confirmed the lack of full-length peptided expressed from this allele. Any potential C-terminally truncated peptide expressed from this allele would lack all functional domains. (J:243414)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count