Clstn2^em1(IMPC)J

This allele from project Clstn2-7604J-M4612 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACGGTGTGCTTGGAAGG, CCTGTCGCCCACCTTCTCCC, TTGTAGATCCAGCTCTGTCG and TCACCATGCTCAACTAGACT, which resulted in a 445 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 97,583,831 bp, GTCTAGTTGAGCATGGTGAAT, and ending after CACCAACGGTGTGCTTGGAA at 97,583,387 bp (GRCm38/mm10). This mutation deletes exon 3 and 249 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 6 amino acids later. (J:188991)