This allele from project Grrp1-7625J-M2529 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCACCACCGACACCGTG, GCGGCGACGTTGCGACCTGA, TCACCCACTACACCTTCGAG and TATCTTTTACCGCCAGAAGA, which resulted in a 698 bp deletion in exon 2 beginning at Chromosome 4 negative strand position 134,252,135 bp, AGGGGACGAACCCCCAGCGCC, and ending after GCGGGACGGACGCCCCACGGT at 134,251,438 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 10 and early truncation 26 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count