Col16a1^em1(IMPC)J

This allele from project Col16a1-7606J-F4542 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGCATTAGGAACTCAGGA, AGAATTCCCGGAGCTCTGCT, AGGTCACTATGAACTCTGGG and TCTACCTATTGTCCACCACT, which resulted in a 437 bp deletion spanning exons 3 and 4 beginning at Chromosome 4 positive strand position 130051616 bp, CTCCTGAGTTCCTAATGCTC, and ending after ACTCTACCTATTGTCCACCA, at 130052052 bp (GRCm38/mm10). This mutation deletes exons 3 and 4 and 244 bp of flanking intronic and intron 3-4 sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 15 amino acids later. In addition, there is a 5 bp (ctctg) deletion 13 bp before the 437 bp deletion that is not predicted to impact the outcome of this mutation. (J:188991)