Adamts16^em1(IMPC)J

This allele from project Adamts16-7577J-M3910 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGACTTGCAGACCAGCATAG, TTGCTGGCTGCTTACCTGTG, CAGTGCCCGCATTTTCACTG and ACTCTGCTGGTCCTAGCGCC, which resulted in a 271 bp deletion spanning exon 2 beginning at Chromosome 13 negative strand position 70,841,480 bp, GGCGCTAGGACCAGCAGAGT, and ending after AAGCAGCCAGCAACCCCCTA at 70,841,210 bp (GRCm38/mm10). This mutation deletes exon 2 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 9 amino acids later. (J:188991)