This allele from project Iqca-7545J-F2516 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAAACCCCACCACCATG, CGAAGAAGTCTGCAGACAAT, GCACCTTTAACAGAACCCAC and GTGGATAGCATTCATCCATG, which resulted in a 524 bp deletion spanning exon 2 beginning at Chromosome 1 negative strand position 90,145,184 bp, TCATCCATGAGGTTGTCTAA and ending after ACTCAAACCCCACCACCAT at 90,144,661 bp (GRCm38/mm10) with a single base pair insertion, A, in place of this deletion. This mutation deletes exon 2 and 199 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change in amino acid sequence after residue 4 and early truncation 11 amino acids later. In addition, there is a 4 bp (gtgg) deletion 39 bp before the 524 bp deletion that is not predicted to impact the outcome of this mutation. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count