Bzw1^em1(IMPC)J

This allele from project Bzw1-7578J-M3933 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATGTGGCTCAAAACTAGCG, ACGCACTGCTTTCTGCCGCC, GTGTGGGTCTTGGTGAAATA and ATATCACCCATATCGCTATA, which resulted in a 308 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 58,398,906 bp, GCGCGGTAGCCCTGGCGGCA, and ending after AAGGGTGTGGGTCTTGGTGAA at 58,399,213 bp (GRCm38/mm10). This mutation deletes exon 4 and 213 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to result in a change of amino acid sequence after residue 112 and early truncation 2 amino acids later. (J:188991)