Rragd^em1(IMPC)J

This allele from project Rragd-7547J-M2556 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCACCTGAACCACCAACCA, AGAAACCCCAGAACAGGAGA, CTCTGATCCCACAGATGCAG, and GGGCACTCCCCTGCATCTGT, which resulted in a 539 bp deletion spanning exon 2 beginning at Chromosome 4 positive strand position 32,995,678 bp, GTTGGTGGTTCAGGTGGCAC, and ending after CTGTTAGAGGGCACTCCCCT at 32996216 bp (GRCm38/mm10). This mutation deletes exon 2 and 243 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after 48 residues and early truncation 1 amino acid later. (J:188991)