Tpd52l1^em1(IMPC)J

This allele from project Tpd52l1-7503J-M9170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGAACTTGAGTTAAGTTA, ACCCGGAAGCGGAATCGGGG, CTTTGAAAAGTCAATCCGCG, and CATTCTTTAAGGTCACTCCG, which resulted in a 361 bp deletion spanning exon 3 beginning at Chromosome 10 negative strand position 31358175bp, ACTCCGTGGTGAGGTCACTT, and ending after TTCAGTCCCGCCCCGATTC at 31357815 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 45 and early truncation 20 amino acids later. (J:188991)