Eipr1^em1(IMPC)J

This allele from project Tssc1-7504J-F7918 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGACAATCAGCATCTCGGA, TCATGAGAACTAAGCTGTAG, GTGTACGGACAGCACCTAGG, and AGATGTCTGTGCTTCAGGGT, which resulted in a 304 bp deletion spanning exon 3 beginning at Chromosome 12 positive strand position 28,766,738 bp, CGAGATGCTGATTGTCCTCT, and ending after CTGTCCGTACACACTGACAC at 28,767,041 bp (GRCm38/mm10). This mutation deletes exon 3 and 171 bp of flanking intronic sequence including the splice acceptor and donor, there is a 7 bp deletion (taagctg) 94 bp upstream (5) of the 304 bp deletion and a 20 bp deletion 13 bp downstream (3) of the 304 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 18 amino acids later. (J:188991)