This allele from project Rab12-7420J-M4534 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCGCATCTCACTGTTAAA, TTTAACAGTGAGATGCGCAC, CGAGGTGCAGAAGTGCATAA, and CCAATCTTGTGCCCCCACCG, which resulted in a 264 bp deletion spanning exon 3 beginning at Chromosome 17 negative strand position 66,500,258 bp, TAAGGGTTTGCACTAGAAGA and ending after CCTGTGCGCATCTCACTGTT at 66,500,258 bp (GRCm38/mm10). This mutation deletes exon 3 and 125 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 94 and early truncation 35 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count