This allele from project Rab11fip3-7419J-M4978 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGCTGGATGAAAGCACAC, GTGCAGCTCCACAAGCCAGC, CAGTCAGTAGGCAGCTATGG, and AACAAAAATAATAATCTCGA, which resulted in a 362 bp deletion spanning exon 4 beginning at Chromosome 17 negative strand position 26,016,187 bp, GCTGCCTACTGACTGTCCAT, and ending after TGTGGAGCTGCACCTGTGTG at 26,015,826 bp (GRCm38/mm10). This mutation deletes exon 4 and 150 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 594 and early truncation 14 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count